Anticipation and Memory

Tears hover where the edges of beauty and tragedy merge.  And the strings of sadness pull gently but insistently on each other.  My son sleeping next to me, his peace, his warmth, his breath all miraculous.  Anticipatory change.  Anticipatory loss. My husband friend lover living half a world away with no clear path back to me. Children losing fathers in Ukraine. Their stories on the radio.  The untold stories of children in Afghanistan, Yemen, Somalia, Ethiopia, Eritrea.  The kindness of strangers. The hatred.  My patients - mothers – having left beloved children hundreds of miles away for hope. The proud smile of Leila Jackson Brown at her mother. The proud insistent desire to sow division and fan flames by those who badger her mother. The vision of a loving radiant interracial family on the global stage.  The distortion of the concept of love by those with power.  The frailty of my father.  Our finite time together feeling small.  A house full of memories and ghosts; a looming project of excavation and deconstruction. My brother’s suffering. His death. His birthday yesterday.  The larger world amplifies the pressure I feel in this season of my life.  Nothing was perfect and nothing will ever be.  Grace is holding all the extremes in one handful and understanding the necessity of it all.

Malawi in January

 Colors are more vibrant, particularly in rural areas. As we drive away from town, I touch my face to see if the effect is from my glasses, but I am wearing none. Perhaps it is the humidity or a horizon where earth touches sky and buildings rise from the fabric of the land.  Red earth births red bricks, which are topped with thatch and the occasional tin roof reflects sun and sky.  Along the road, a string of kiosks, simple thatched shelters, their hand-painted signs distinguishing one from its neighbors.  “Dine Fine.” This morning a young woman peers into a pot and stirs in her roadside café.  The rains are late, but they have arrived, and from a distance the damp earth seems to bear its first fruit - bright colors are grouped together among the tilled rows.  Men and women - mostly women - in vibrant prints, bend at 90-degree angles with hoes raised then thrusting downward.   A landscape of sienna and green against a blue-purple sky.  Six bunches of bright green lettuce stand alone in the open frame of a small teal-painted village store.  A woman’s red skirt catches my eye from where she stands in a field of black soil.  Men herd cattle and swat at two bulls whose flaring tempers blind them to their surroundings. As they butt heads one suddenly shoves the other into the road.  Our driver swerves in time and chuckles.  The beguiling beauty leads your mind’s focus away from the poverty.  This is a season of hunger.  Food stores are low and without irrigation all hopes rise upwards, coalescing in the heavy clouds. Perhaps hope alone becomes heavy, each thought a particle drawing in moisture and culminating in the thunderous precipitation.

A Return

I arrived. The warm heart. The dark heart. A country so far away and made to sound so exotic that it might exist in another reality. A dismissible reality. There are some freshly paved and widened streets. There are more buildings and more cars, but mostly it is unchanged. A short distance from town the edges of the two-lane highways remain eroded. At points the bites taken by years and seasons of rain have left the road just wide enough for two vehicles to pass traveling in opposite directions. Men in threadbare suits ride single gear bicycles along the tattered edges. Do they pray with the sound of each vehicle approaching from behind to overtake them? Or has necessity made them fearless? 

 There are the sounds I hadn’t remembered to miss. Crickets and frogs at night. The purring of ngumbi wings hitting my window, their spasmodic fluttering imitating breathing or soft steps in gravel. They are drawn to the light on the khonde and then crawl under the door. Just fluttering now against the frame, in the ditch formed by the groove of the sliding door. They are there fluttering their wings off. In the morning I will find their inert bodies littering the khonde and sprinkled over the floor closest the door. Then there is the bark, no, the stuttered cough of a dog from a distance. I can hear the leash tight around his neck. Drifting to sleep I remember the man with the security company. I once walked through his yard where he kept the dogs and turned quickly away from a man beating one savagely. “They need to be mean” I was told. So, these men, working for less than would feed their families, beat the dogs. I wondered what happened to the hearts of the men. Where else were they now capable of rationalizing brutality? Or were they simply harnessing and turning their own daily passive brutalization on the dogs? I was only slightly surprised to later learn that the company owner was a pedophile. He played the role of the beneficent uncle well. In truth, it was the dependency he savored. The dependency of his siblings and his community, that kept their mouths silent as he took young girls to his bed. Who would want to upset peace and stability which merely demanded the sacrifice of a few young virgins? And, who to call? What force of justice might come to rescue the girls, when their own families consented to their sacrifice? 

 “Madam” they call me. Excessive deference to the entitled. In the beginning, even my mother and father-in-law would say madam to my light skin and blue eyes. Here there is still permission to remain comfortable with just a little ordinary racism. No one needs to stand on guard against their own implicit biases. No one will call you out. You may allow them to comfortably ooze out around the edges. Egos buffed with soft microfiber cloths “madam” “madam”. You may request your house boy to wear white gloves and stand to the side of the table as your guests eat. You may gently scold him with a look when the wine bottle slips from his gloved fingers. Afterall you are paying him well, and you are paying his daughter’s secondary school fees. He is so grateful. Without you, where would he be?

For the Love of Craig

I met my brother in 1980 on a cold January day at a foster home in Detroit. I had been waiting for him as far back as my four-year-old memory extended. I remember the joy, the anticipation, and the immediate sense of protectiveness seeing him among the other children in the house. Later, I remember him on the car ride home, his little blue hat and scarf meeting to obscure my view of his sleeping face. No one knew then that inside my peaceful 10-month old brother was a dormant force which would eventually claim his life. Our siblinghood took off from there. Energetic was a euphemism for his behavior in childhood. We played. We fought. We found our own paths. We grew in proximity, together and apart and together again. I moved across country for college and hardly looked back. I traveled the world, attended nursing school and became a midwife. He stayed in Austin, where we were raised, worked as a mechanic tec in local garages. I found my joy being with women, listening and supporting them through the adventure of birth. He found his with grease on his hands, deep in the mechanical bowels of cars. When he was in his mid-twenties, I started to become aware of something changing him from within. He twitched when standing or sitting still. I saw him awkwardly kick out his leg when bending to pick something up. He said he had back pain. I left for Africa. When I returned home for a visit, he was living with our parents. He had failed to tighten something important on a car and lost his job. He dropped things. He banged things. The twitching worsened. His toes moved as though they were playing the piano. People around us whispered accusations of drug use. He denied it. I made a long list of neurological diseases and started crossing them off. I requested his medical records from the various doctors he had seen over the previous decade. We searched for his birth parents. We found the death certificate of his mother. She had died at 40. He was 13. Typed on the line beside “Cause of Death” sat the ominous words “Cerebellum Degenerative;” not a true diagnosis but a clue. I returned to Africa. I had my first baby. At that point I had been a midwife for seven years. I had helped hundreds of women during their births. My midwife told me that labor was like a wide river that you had to cross. There were women on the other side cheering you on, but the journey was yours alone. It was hard. It was amazing. I reached the point when panic threatened to through me off course. I had incredible people with me cheering me along and I made it. I kept my eyes closed for hours but whenever I reached out my hand, someone grabbed it and steadied me. A few months later our dad took him to a neurologist who, after an hour’s evaluation, said he thought it was Huntington’s Disease. My brother, who rarely found a reason to be online, spent hours in front of the computer, pouring over stories and statistics which he synthesized and reported stoically as an assortment of lurid and distressing facts. · The life expectation for Huntington's patients is 10-15 years after the onset of symptoms · Huntington’s patients often die from choking, suicide and pneumonia · Huntington’s is known as the Dancing Disease, it is also often called the cruelest disease · If one parent has it, the child has a 50% chance of inheriting it · The course of the disease experienced by an affected person is often similar to that experienced by their affected parent · Huntington’s Disease is caused by an abnormal number of repeats of the CAG trinucleotide on the HTT gene. CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG These facts registered viscerally. I watched him and suddenly I could hear his demon laughing CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG. On August 31, 2011 a social worker wearing an uncomfortable smile in a room full of people named his demon. Forty-one laughs. That was the only time I saw him cry. Knowing made nothing easier. He was 32. Life continued, at that time mine was mostly in Africa. During my visits home I watched the demon beat out its own rhythm in his body, transforming his walk into a grotesque dance to silent music, arms flying, legs stepping high, body careening wildly. I saw the holes punched in the walls, made when the demonic force would fling him unexpectedly across a room. More than once I heard the thuds of his body as that force shoved his muscular six-foot frame down the stairs or knocked him over in the shower. I saw the bruises on his face and cuts on his arms from the beatings he never knew were coming. I watched the demon throw his food on the floor at the last moment as he lifted his spoon to his mouth. His room was moved downstairs, grab bars were installed. While I was home, I helped him eat and shower. He stopped reading and talking about Huntington’s Disease. He was living it. His depression was dark and I did not know how to add light. I returned to Africa. I had another baby. Labor was still hard. My midwife whispered in my ear, “Don’t be afraid.” My husband brushed my hair and rubbed my feet. My body felt it might tear in two and then our baby came gently into the world. At some point Dad knew my brother could no longer live at home and he was moved into a nursing home two hours from Austin. The transition was difficult. He was angry and the facilities (he moved 3 times) always struggled to care for him. He was not like most of their other patients. He was young, and mentally alert, and unwilling to submit to routines. Over time his speech deteriorated. It took effort for him to form words; communication demanded time and patience from those listening. Those who were short on patience assumed he was demented or developmentally delayed, and in turn, he would resist their care with everything he had. Those who had patience were rewarded with his elusive smile. Over time he walked less and less. His sentences gradually shortened to one or two words. Even “yes” and “no” became difficult to understand. I returned to Texas in 2014 with my family and saw him more frequently. I would tease him to see a smile. I would take him outside, light his cigarettes and hold them while he smoked. (When he entered the first nursing home, he resumed smoking after a ten-year break. He said the big H would get him before the big C.) I would cut his hair and wash his face. Apart from “yes” and “no.” He would say, “Thank you.” Every time I offered him a bite of food, he would say, “Thank you.” That always hit me in my heart. In 2017 he moved to a nursing home in Austin and dad started visiting him daily. I visited weekly. In early 2020 he lost his voice entirely. They gave him a speech device. He could touch, “yes” or “no” and phrases like “I want to smoke,” “I miss you,” and “I want thickened juice.” Swallowing was a problem; each bite and sip held both life-sustaining and life-threatening potential. The violent coughing fits from mis-swallowed sips instantly brought tears and fear to his eyes. In early March they told us they would be closing the nursing home to visitors indefinitely due to Covid. That night I came straight from work, I punched in the security code at 9pm and made my way to his room. I cut his hair and his nails. I straightened his room while he slept and kissed his forehead. He would be 41 in a week. In the time we couldn’t visit I thought about him and his life, about the hardness, the misunderstandings. I thought about his birth mother, Margaret Pohl. She was 28 when he was born. The adoption was closed, but our mother knew that Margaret had had a hard time giving him up. The story was that she dropped him off and returned to retrieve him several times from the foster family before she finally left for good. She must have been symptomatic. She must have known. She must have had a parent who suffered the same. She must have witnessed the disease. She must have struggled with love; wanting to keep him in her arms and knowing that if she did, he would witness her personal accelerating tragedy and ultimately end up orphaned. I imagine she prayed that he would be adopted into a loving family. I wonder if that hope gave her comfort through the years spent fighting her unwinnable fight. I wondered if we did right by her. She would want him to have a peaceful death and leave this life loved. I also thought of Judith and Maggie, two guiding lights for me. Midwife and hospice nurse, both in their 70s, dear friends who spoke of the parallels between caring for those entering and leaving this life. From March to August Dad and I saw him over video calls and talked to the nurses. His weight dropped from 141 to 132 to 125 to 118 to 114. I worried that he would die alone. We prayed for a good death. On August 31st the facility called to say his we could visit, his weight was 105, they thought he had days left. Hours later the hospice nurse said, “Come now!” Dad and I arrived together. His head was tilted back over the pillow, his mouth gaping, his eyes open staring at nothing. He was skin pulled over bone. I kissed the familiar scar on his forehead. I felt the worlds touching. As I held his hands, his purple fingers weakly squeezed mine. Dad sat at his side with his hand on his arm. We called the priest who came and blessed him and prayed. I thought of laboring women moving through transition. I thought of my experience. I dimed the lights, turned on soft music and the diffuser. He tried to adjust himself and I saw the anxiety in his face. An aide helped me straighten his body and his tension eased. I brushed his hair. When the anxiety creased his brow again, I whispered, “I love you” in his ear. The journeys of birth and death mirror each other; they provide the punctuation and symmetry of life. For both, there is no option but complete surrender. Both must be traversed alone, but both are easier completed with hands to hold. I felt swept up into an all-consuming love. In the same way I know a woman will make it through, just when she feels her body will break in half, I felt certain this was a transition to something good. He needed us to keep him steady. “You will be okay, Craig, relax into the love.” We sat there holding him as his breathing slowed. And then he was gone. I put my ear to his chest and kissed his scar one last time. He died August 31, 2020.

My Brother's Demon (July 2017)

The US was an adventure all its own this time. The plan was our usual summer routine – we would live with my family, I would work full-time in L&D for five months and Clement would stay for three months. When we pulled up to the house, the sight of my 32 year old brother moving spastically behind the lawn mower informed me that things would be different.

Over the past several years my brother’s body has been changing. I first noticed his constant fidgeting and occasional spastic movements when I came home in 2007. He saw a neurologist in 2008 who told him all was normal and Craig explained his strange walk and shiftiness as a coping mechanism for his chronic back pain. Over time he began dropping things more frequently but the insidious change made it easy to believe he was merely inattentive. In 2010 when I came home, it was clear to me that a still unnamed demon was claiming more and more of my brother. I requested copies of his medical records from all the physicians he had seen over the past ten years – several general physicians, one pain specialist, and one neurologist. While my brother hunted for a job as a mechanic - which I saw as a sad futile task, imagining what a prospective boss might think as my brother walked into an interview - I tried to enroll him in a medical assistance program for the indigent, and with less than $2 in his bank account, he qualified. We took the first available appointment for three months out.

In one doctor’s note I read that my brother told the physician that he would try to get information about his birth parents. When I asked my brother what he had done, he told me he had not gone further than asking our parents if they had any information. My parents adopted my brother at the age of 10 months. A social worker initially told my parents they were unlikely to receive a child - because they were old, they already had a child, and they were an interracial couple. When they found my brother, an active toddler who also happened to be biracial, they were overjoyed. It was a closed adoption in 1980. Craig and I filled the paperwork to search for biological relatives and after several months an envelope arrived. The agency was unable to find anything apart from his birth mother’s death certificate. She had died in Detroit in 1992 at the age of 40. At that time she was living in a nursing home with no family listed. She died from a heart attack but also suffered from “cerebellum degenerative.” The news was a blow for my brother. He would never meet the woman who had brought him into the world. Even if he had not previously thought much about her, now she was real. She had a name. He knew the name she had given him at birth. He knew she had died alone when he was 13. He became quiet and sullen.

For my part, I became obsessed with the “cerebellum degenerative” on her death certificate. We went to the first appointment hoping to meet a physician who would refer Craig to a neurologist and were told that the doctor was out for the week and that we would have to reschedule for the next available appointment, two months out. That appointment never happened due to another conflict, and then I was on my way back to Ghana. Craig’s enrollment in the medical assistance program lapsed. A few months later our Dad took Craig to a neurologist and paid for the visit out of pocket. A second MRI was ordered. During the result visit the neurologist spent an hour and a half with my brother and father, reviewing the past medical records, the MRIs, the death certificate, and conducting a thorough exam. He told them he suspected Huntington’s Disease.

Huntington’s is a genetic neurodegenerative disease. A person with one affected parent has a 50% chance of inheriting the abnormal repeat cagcagcagcagcag on a certain gene. When Craig told me, I imagined a demon laughing, “cagcagcagcag.” Any person with the mutation will eventually become symptomatic, usually in their 40s or 50s. People generally survive 15-20 years after they become symptomatic. Those who become symptomatic earlier generally experience a more aggressive form of the disease. Huntington’s was previously known as “the dancing disease” due to the characteristic chorea or exaggerated movements. Uncontrolled movements become more and more severe while the muscles simultaneously weaken. The person gradually loses the ability to walk, to speak, to swallow. Craig told me that the most common causes of death are choking, infection, and suicide. A person without the mutation cannot pass on the disease. Craig has a daughter.

Due to the prohibitively high cost of genetic testing and the possibility of Craig needing several genetic tests, following a negative result for Huntington’s, the neurologist advised us to try to get the medical records of his birth mom before doing the genetic test. We were unsuccessful at obtaining medical records so when I returned to Texas this year, I called the genetic counselor at the center for movement disorders in Houston and scheduled an appointment for the genetic test.

My mother is also entering a new challenging phase of life. She turned 80 in October and though physically youthful, is living with significant dementia. People and tasks that were once familiar and simple are now unknown and challenging. She no longer drives or cooks. A thought will come and pass in the same moment. The direction of an act is lost on the way to carrying it out. My beautiful joyful faith-filled mother has lived so that her light fills spaces and hearts, but when we arrived I found her light muted by confusion and frustration.

Thulani was her medicine. During our months in the States, she fell head over heels in love with him and in his presence she was bright and alive. Every day she would move with him around the house, showing him all the pictures and art on the walls, turning lights on and off in the rooms, moving outside to look at flowers, and finally ending their daily tour near the statue of St Francis out back, helping Thuli touch the birds on his shoulders. She showed Thulani how to knock on doors, how to open and close drawers. One day I found them digging together in a planter. I could see the joy they both received in touring the world with fresh new eyes. She told me one day, “You know I love Thulani more than you,” and I laughed just so happy that they had each other. In her love for her grandson, I saw her love for her daughter, and imagined her has a new mom. She wanted him to experience the world in her arms, whether that was looking at the sky and the trees, or eating pasta and sausage and sipping Dr Pepper at four months. I had to stay alert. By the time he could move in a walker he would run to her with his arms outstretched in the morning or search for her in the laundry room when she was not around. I worried about their separation.

In August Clement returned to Ghana. Mom, Dad, Craig, Thulani and I made two trips to Houston for Craig’s genetic test and result. On August 31st 2011 in the presence of a psychiatrist and medical intern, the counselor clumsily delivered the positive result with a smile. The medical support team then sat awkwardly watching as my brother sobbed. We left. Afterwards, Craig spent hours online reading articles and watching videos about Huntington’s Disease. This was his demon, the one hiding in every cell. For years it was there, invisible but silently laughing “cagcagcagcagcag cagcagcagcagcag cagcagcagcagcag cagcagcagcagcag cagcagcagcagcag cagcagcagcagcag cagcagcagcagcag cagcagcagcagcagcag.”

So this was the new home, a home of transition, some loss, some sorrow, some change, some joy, and love. My father, at age 76 still works and would kindly tell anyone concerned that they are doing well, that they are managing. We would disagree about the managing part. I felt everyone could do with better nutrition and more support. At one point, Craig decided he could meet his caloric needs best by blending huge wedges of chocolate cake with raw eggs and milk (he must consume 3000 calories daily to maintain his weight). Mom would say she was hungry and then the next minute, tell me she had eaten. The house needed cleaning. They all needed rest, especially dad. Dad would tell me that things would work out, that he was changing his routine to care for them. We all did our best.

I filled out the paperwork for my brother to get on disability. I made phone calls and spreadsheets. I bought Craig manageable clothes and shoes (no more buttons, zippers, snaps, or laces). Every day rushing to squeeze in my year's contribution of support into my remaining days in Texas. Dad hired someone to install grab bars in the shower and bought a special chair for the table. We all went to support meetings for Craig. We prayed. I did a lot of worrying. It was exhausting and overwhelming. I irritated my parents with my “need to take over.” They assured me they would manage and that we must return to our life and to Clement in Ghana. At the end of October, mom and dad drove Thulani and me to the airport. Mom and Thulani and I all cried at our separation, perhaps all for different reasons but all because of love.

Tonight

I am waiting with a family for their daughter. I found the mother tucked into a labor bed wearing a calm expression and breathing with quiet force through the pain; her husband sitting in the chair beside her. Their children he said, not allowed in the labor ward, waited just outside. Three girls 11, 8, 5, and 1 boy age 3. The children have been waiting for hours. It is now 10pm. I tell him the baby may still be hours away, the children should go home and sleep. They do not want to leave without their parents. When the baby is born they will go home together.

I pass by to meet them. They are not fighting, just quietly waiting; the oldest on a phone, the baby boy dipping french fries in ketchup. Their father says they never want to leave him. They traveled from Honduras to Mexico by bus. They would sleep sitting upright body against body. They stayed in Mexico for some time. When he would work clearing land and walk all day, they would follow. I imagine the little boy sometimes on his father’s shoulders, sometimes trailing behind, always watched by sisters. Moving as one. Love binds. The father says they live the life God gives. This is the first delivery in the US. I imagine another setting, her children around her, their baby tumbling out into the warmth of the family’s enkindled love.

I imagine my own small people snoring in quiet whispers, three beds in one small room, street light and tree shadows dancing over their forms; arms tossed across pillows, mouths softly open. My heart hurts with love.

Now

In 2018 I am in Texas with my Malawian husband. We are here raising three boys. We left Africa to be close to my parents and my brother. My mother died last January in 2017 after a long slow decline. My brother is dying slowly. My father is bearing witness and spending time with his grandsons.

My brother's Huntington's disease has progressed transforming him from a man who loved riding motorcycles and fixing cars, to someone whose toes seemed to play an invisible piano in 2007, to a man whose body dance eerily and uncontrollably in 2013, to a man who at age 38 lies in a bed in a dark room in a nursing home for most hours of the day. He can move his body with powerful spastic energy going from an inert form to upright in a second, but he cannot balance, he cannot walk, he cannot feed himself, he struggles to swallow, he struggles to talk. His mind remains clear. He enjoys smoking and pie. Recently when I asked him if he was ready for a DNR (Do Not Resuscitate) order to be placed on his chart he said "I have seven years" in an unusually clear voice. When I asked him what he enjoyed he said, "smoke." I said, "And, what about MY visits?!" feigning offense and he smiled. I'll take that, coming second to cigarettes and getting the occasional smile. He has very little outside of a desire to live. He has his TV tuned to a channel that is one long continuous Law & Order marathon. His neighbor is an elderly man with dementia who bursts into loud conversation with unseen friends periodically day and night. One thing my brother has going for him now is that he is so easy to love. This was not always true. But now, I feed him his pie, he says thank you after each bite and I feel so much love.