BugTracks

Behold! This little fly emerged the day before yesterday.

It might look like a pretty generic fly (it happens to be an agromyzid in the genus Agromyza), but take a look at the lid of the vial in which it appeared:

My already indecipherable writing has been made worse by its being partially faded or rubbed off over time, but what it says is “6/6/23 / Long Mtn / fuzzy brome / B. pubescens / 5 lvs, all out by 6/12-13 / Full depth.” Which is to say: the vial contained puparia from five mined leaves of a fuzzy-leaved brome (grass) that I collected at Long Mountain (in Belchertown, Massachusetts) and determined to be Bromus pubescens (common name = “hairy woodland brome”); the mines were full-depth, meaning they were equally visible on both sides of the leaf, and all of the larvae exited the leaves and formed their puparia by June 12 or 13—not 2024, but 2023! I’m not aware of any recorded instances of agromyzids having a two-year pupal diapause, but the puparia still looked to be in good shape last fall when I was discarding rearing projects that were no longer worth keeping, so I decided to keep them for another winter. And this one is a male, so it will be identifiable to species, once Owen Lonsdale has a look at its genitalia. My decision not to give up on these puparia just yet was influenced by the fact that there are no records of any Agromyza species being reared from any Bromus species in North America.

Here’s a photo I took of one of the mined leaves as I was collecting them. As far as I can tell, the mines of all the grass-feeding Agromyza species look exactly like this, although some are visible only on one leaf surface, which is why I made the note about these being full-depth.

And for those who are curious, here is what the inside of the rearing vial looks like after almost two years. Plenty of black mold growth on the crumpled-up piece of toilet paper I stuffed into the bottom with a few drops of water added periodically to maintain a somewhat humid environment, but most of the puparia themselves are still not moldy, which is what gave me hope that they might still be viable.

Relatedly, on March 18 I was excited to discover that two sawflies had emerged in one of my peanut butter jars with soil in the bottom. I looked at the lid and saw that some inchworms had burrowed into the soil last spring. Were these actually ichneumonid parasitoids that I had mistaken for sawflies? I took a closer look:

Nope, definitely sawflies! Specifically, a female and male of Nematus abbotii (Tenthredinidae). I looked at the older writing on the lid and saw that on June 11, 2023, I had collected some sawfly larvae from bristly locust (Fabaceae: Robinia hispida), and five of them had burrowed into this soil by June 14. A male and female of N. abbotii had already emerged in this jar on April 3 and 9, 2024, so when I needed soil for those inchworms two months later and no more sawflies had emerged, I figured I could just recycle that soil—but I didn’t cross out the older writing in case something like this happened. (I should also point out that when I recycle soil like this, I make sure not to reuse sawfly soil for sawflies, or gall midge soil for gall midges, etc.) Here’s what one of the larvae looked like:

Nematus abbotii has not been reared before, but in a paper published in 2008*, Dave Smith reported that shortly after catching many adults of this species in a trap that was set among black locust (Robinia pseudoacacia), he noted “a number of edge-feeding, dark-spotted larvae on the leaves of the trees which were undoubtedly those of N. abbotii.” Sadly, Dave, on whom I always depended for sawfly identifications, passed away between the time I collected these larvae and the emergence of the first adults. A curious thing is that 40 years ago, Dave and Chris Darling published a paper describing a new species, Nematus hispidae (now Euura hispidae), which Chris had reared from very similar larvae on bristly locust at the Cornell University campus in Ithaca, New York**. Larvae of both species are initially solid black, as seen here in a photo taken as I was collecting the N. abbotii larvae:

And evidently the species of locust on which they are found cannot be used to distinguish them, as might have been assumed previously. One difference that seems to be consistent is that whereas E. hispidae inserts its eggs in the leaflet midribs, N. abbotii inserts them in the rachis of the compound leaf—as was first documented by Yurika Alexander on BugGuide, and I found similar oviposition scars in association with the larvae I collected.

Dave told me in 2022 that he was unaware of any specimens of E. hispidae beyond the type series, whereas N. abbotii has been collected all over eastern North America, from Ontario to Georgia, west to Kansas. So it would not be unreasonable to assume that larvae like this are N. abbotii, unless you happen to be in Ithaca, New York…

Sawflies sometimes having a larval diapause of two or more years is a well-known phenomenon, but I have only experienced it firsthand once or twice before. Gall wasps (Cynipidae) have been reported to emerge from galls collected several years earlier, and I believe I remember reading that gall midges (Cecidomyiidae) can emerge as adults as many as twelve years after burrowing into soil as larvae.

I’d like to close this post with a little PSA for BugTracks subscribers. At some point, WordPress switched from sending subscribers an email with the first few lines of a new blog post followed by a link, to sending emails that have the entire blog post embedded, complete with illustrations. This has led many people to forget, I think, that my blog is a thing that exists out there on a website, and is not just something you are getting in an email from me. When you respond to one of these blog emails, you are not writing a private message to my email account; you are leaving a comment that will be posted publicly at the bottom of my blog post. I moderate comments before they appear, so I haven’t been approving comments that are clearly not intended for public consumption, but it is not always clear to me what the intent is. Also note that in many cases these comments appear anonymously, so I don’t know who to respond to if you write with a question. For instance, someone wrote in response to my last post, “I didn’t get any photos with the email. Maybe it’s my end??” The answer to that is yes, the problem is at your end, and the solution is to click the title at the very top of the post so you can read the blog on my website! I would really suggest that everyone do this, because I very often add some edits or updates after publishing a blog post, and these changes will not be reflected in the emailed version.

* Smith, David R. 2008. The abbotii and erythrogaster groups of Nematus Panzer (Hymenoptera: Tenthredinidae) in North America. Proceedings of the Entomological Society of Washington 110(3): 647–667.

** Darling, D. Christopher and David R. Smith. 1985. Description and life history of a new species of Nematus (Hymenoptera: Tenthredinidae) on Robinia hispida (Fabaceae) in New York. Proceedings of the Entomological Society of Washington 87(1): 225–230.

This may not be the most exciting read, but it will give you a little window into the sorts of problems I’m wrestling with while trying to attach names to the insects I’m studying, as my country crumbles around me. I was asked a seemingly simple question by Steve Nanz this morning, and the more I thought about it, the more it made my head hurt. Instead of writing an extremely long response in a BugGuide comment, I thought it would be useful to lay some things out in a blog post. Might as well start from the beginning…

Gracilaria quinquistrigella (Gracillariidae) was described by Kentucky lepidopterist V. T. Chambers in 1875 from a specimen caught in Texas (he misspelled the genus, which should have been Gracillaria). Its host plant was unknown. Very little has been published about this species since. Forbes (1923) included it in Lepidoptera of New York and Neighboring States, under the name Acrocercops quinquestrigella (misspelled), and quinquistrigella was still listed in that genus by Don Davis in the Hodges et al. (1983) Checklist of North American Lepidoptera. Forbes indicated that Coriscium rhombiferellum, which was described in 1876 by the German lepidopterists Frey & Boll from another specimen caught in Texas, was a synonym (based on what evidence, I don’t know), but Don listed rhombiferellum as a valid species (not having seen the type specimen, as far as I know). Based on my quick reading of the original description of rhombiferellum (in German), it doesn’t sound like the same moth, but it would be nice to see it to make sure. Frey & Boll’s specimens are mostly at the Natural History Museum in London, and today I wrote to the curator who in the past has provided me with images of such things, but I got an auto-reply saying that he is on leave. Anyway, Forbes stated that Acrocercops quinquestrigella occurs in Kentucky and Texas—neither of which are “neighboring states” of New York, last I checked—and I think this must have been an error based on the fact that Chambers lived in Kentucky. Charles Kimball’s 1965 Lepidoptera of Florida includes Acrocercops quinquestrigella based on three specimens reared from Sida rhombifolia (Malvaceae) by Carl Stegmaier (who later published a series of papers about Florida’s leaf-mining agromyzid flies), dated March 7, 1963. Charles Covell, in his 1999 checklist of the butterflies and moths of Kentucky, included A. quinquistrigella based on Forbes’ error. And that’s it.

In November 2012, Julia and I collected some leaf mines on narrow-leaved globemallow (Malvaceae: Sphaeralcea angustifolia) in Texas.

When finished feeding, the larvae exited their mines and spun cocoons. One did so at the bottom of a rearing vial, so I was able to get a look at the larva inside its cocoon through the side of the vial:

Here’s the finished cocoon viewed from above, now containing the pupa. Note the “frothy bubbles” on the surface of the cocoon at either end, which are characteristic of certain gracillariid moths.

I ended up getting only parasitoid wasps from the larvae we collected, but we also collected one cocoon along with the mines, and an adult emerged from it. Here’s the cocoon with the empty pupal skin poking out of it…

…and the adult:

I tentatively identified this as Acrocercops quinquistrigella based on Kimball’s record from Florida; at the time it was the only published record of a gracillariid reared from a mallow in North America, and the description of the adult was a good match.

Five years later, Mike Palmer collected leaf mines in Oklahoma from an unrelated plant called betonyleaf noseburn (Euphorbiaceae: Tragia betonicifolia). The only leafminer known from Tragia was Cyphacma tragiae, a weird moth that Annette Braun described in 1942, which currently is not assigned to a family or even a superfamily. Here is one of the adults that emerged from Mike’s mines:

Braun had mentioned that sometimes the cocoon of C. tragiae is decorated with a few frothy bubbles, which would be a really weird coincidence since these bubbles are otherwise unique to Gracillariidae (and C. tragiae definitely isn’t a gracillariid). I suspect that Braun observed some cocoons of this species that Mike found, didn’t have adults emerge from them, and assumed that they were made by the same species she reared from plain cocoons. But what was Mike’s moth? On October 15, 2017, I wrote to Don Davis:

I’m curious for your thoughts on the moths in the two [above] photos.  The first was reared from Sphaeralcea angustifolia in Texas a few years ago; I had thought it might be Acrocercops quinquistrigella, since this species reportedly has been reared from Sida rhombifolia (both Malvaceae).  The second emerged just yesterday from Tragia betonicifolia (Euphorbiaceae) in Oklahoma.  They look to me to be the same species, despite such distantly related hostplants.  I’m wondering what the status of A. quinquistrigella is, given that it was described from a caught specimen that may or may not still exist.  If these moths are that species, it seems that it may really belong to another genus?

Don replied:

Thanks Charley for the photos and interesting notes. Your photos closely resemble the few Acrocercops quinquistrigella in [the Smithsonian] collection (including the type) but the male genitalia should be compared. Unfortunately the few specimens that I have are mostly missing abdomens (including the type) and I have only been able to draw the female genitalia. One specimen that we have was reared from Sphaeralcea in Texas [in 1939]. . . Please collect all you can for future comparisons.

Don sent this photo of what he said was the type specimen:

On July 5, 2019, Don wrote:

Hi Charley:

Would you be interested in contributing as a co author to 2-3 MONA [Moths of North America] volumes on the North American Gracillariidae? I have completed most of the illustrations (see attached list) and have already published on some species (a few with you). Dave Wagner has asked to be included as the third author on this project. It would be good to have someone primarily responsible for the descriptions of the adults, which perhaps you and Dave could do. I would be able to describe most of the genitalic morphology, and hopefully complete any remaining illustrations. We should also include distributional maps for the species.

The first volume would treat the subfamily Gracillariinae. A few years ago I began portions of the first volume (see attached) and this needs to be updated and completed.

I still have a few other projects to complete, but hope to start working on the Gracillariinae more next year, if I can receive some help.

Please let me know if you are interested in this project.

Best wishes,

Don

I knew from previous correspondence with Don that he was aware of over 100 undescribed species in addition to the 300+ already named species of Gracillariidae in North America (which he had been studying since the 1960s, even if he said he hadn’t begun work on this monograph until “a few years ago.”). I also knew from previous discussions with Dave that Dave’s contribution would be limited to the extensive rearing that he had already done, beginning in the early 1980s; he was (and is) too busy with other things to have any time for describing or writing about Gracillariidae. So I was aware that this would be no small undertaking, but I eagerly agreed.

I began by comparing Don’s species list against the one I had made for Leafminers of North America, which followed the recent reorganization of Gracillariidae into eight subfamilies (previously there were just three, and most of the new ones were split out from what Don was referring to as Gracillariinae). Earlier that year, Greg Pohl had enlisted me to take the lead on the Gracillariidae section of the new Annotated Taxonomic Checklist of the Lepidoptera of North America, north of Mexico, so going over Don’s list complemented that effort well, and of course I invited him to be a coauthor.

When I came to the Acrocercops section, I found that almost nothing in that genus actually belonged there. Don had determined that three species belonged in the genus Cryptolectica, which hadn’t been documented as occurring in North America previously. We also transferred A. cordiella, a Cuban species that Don had found in Texas, to Dialectica and added it to the list. Three other species, A. arbutella, A. astericola, and A. pnosmodiella, are misplaced in Acrocercops but Don hadn’t determined the correct placement, so we left them there with the “Acrocercops” in quotes. In the file Don sent me, he had a note by quinquistrigella: “n. gen. [new genus] in Lithocolletinae?” Operating under the assumption that the globemallow leafminer was in fact quinquistrigella, it was clear to me from the larval biology that this species does not belong in Acrocercopinae, since one of the defining characters of that subfamily is that the larvae turn bright red when mature. Lithocolletinae also wasn’t a good fit, and the general appearance of the leaf mine and adult (as well as the frothy bubbles on the cocoon) fit well with Ornixolinae, so we moved it there. It obviously didn’t make sense to keep it in Acrocercops, and we also couldn’t revert it to the genus Gracillaria, since that is in the subfamily Gracillariinae, so we just listed it under “unknown genus.” This left just A. rhombiferellum (discussed above) and the oak leafminer A. albinatella under Acrocercops, without quotation marks—and whether A. rhombiferellum really belongs there needs further investigation.

And then Don had listed under “NEW GENERA – Gracillariinae” the species albomarginatum, described by Walsingham in 1897 from Saint Thomas in the Virgin Islands. Next to this name, Don had the note, “Devil’s Den, AK, 16744 TL = St. Thomas” (TL meaning type locality). Devil’s Den is in Arkansas (AR), not Alaska (AK). Walsingham had described the species in the genus Coriscium; somewhere along the line it had been transferred to Acrocercops, but Don had determined that it belonged to an undescribed genus.

Beyond putting together the updated checklist, work on the Gracillariidae monograph stalled, because Don wanted to finish his monograph on fairy moths (Adelidae) before turning his attention to this family, and then COVID-19 happened and Don was shut out of the museum for over a year—and he had no computer at home, so I don’t think he was getting much done there, if anything, and there was no easy way to communicate with him. In May 2020, I added a note in Don’s file next to albomarginatum, “looks a lot like quinquistrigella (Ornixolinae)”—but I have no recollection of ever discussing that with Don, and in the final checklist (published in 2023) it is listed with the other three species under “Acrocercops” in quotes, with the note that it “is included in this list based on specimens in the USNM [United States National Museum] collected at Devil’s Den, AR.”

Don’s fairy moth monograph was finally published in 2023, just in time for all the new species he described in it to be included in the new checklist. Meanwhile, he informed me that now he had two other projects that he wanted to finish before turning his attention back to Gracillariidae. He was still working on the first of these when he passed away in October 2024. A huge loss, to say the least.

In the past few weeks, after a long hiatus, I’ve returned to dissecting tiny moths and trying to learn to make slides of their tiny tiny genitalia that are presentable enough to be published, so that I can start describing new species on my own. It’s going pretty well, except for some frustrations like brownish blobs surrounding the genitalia (caused by incomplete mixing of the clove oil that I’m supposed to leave the genitalia in for a few hours before putting them in Canada balsam on the slide), and the difficulty of removing a zillion specks of dust from the coverslip, which are invisible until viewed under the compound scope (the example below is from a male of Parornix betulae):

At this point I’m not sure if it would be more time-consuming to try to use a photo editing program to get rid of all the imperfections in my images, or actually do the tedious things that knowledgeable people are telling me I need to do to fix these issues.

Anyway, this morning Steve Nanz commented on this photo of a moth in Oklahoma that I had identified as “Acrocerops” quinquistrigella in 2017, noting that this moth’s DNA barcode had matched it to a specimen that Don Davis had identified as “Acrocercops” albomarginatum. He asked for my feedback on his treatment of this species on BugGuide and the Moth Photographers Group website. I had forgotten all about this species, but after looking into it, I have these comments and questions:

There are photos of the type specimen and its (male) genitalia here. That’s very helpful.

In his “1933” (actually published in 1934) paper on the Microlepidoptera of Cuba, August Busck wrote of this species (under the name Neurobathra albomarginata): “Described from St. Thomas and recorded from Porto Rico by Forbes, but foodplant hitherto not ascertained. Mr. Otero reared the species repeatedly from leaf-mining larvae of Bradburya plumieri. (Otero No. 9679.)”. That plant is now known as Centrosema plumieri (Fabaceae). Did Busck dissect one of these reared specimens to confirm that it was the same species?

There are several species of Centrosema in the US (some of them known as “butterfly peas”), but to my knowledge no one has found leaf mines on them that could possibly have been made by this moth. Presumably Don compared the genitalia of a male from the US with the type specimen to make his determination. But the two specimens he identified as albomarginata that have DNA barcodes (here and here) were collected by Don and his wife in 1984 in Oklahoma (well away from the Arkansas border), not in Arkansas. Why didn’t he mention these, or are these in fact the specimens that he said were collected in Arkansas? And what evidence is there that this species isn’t synonymous with quinquistrigella, if the type specimen of that species is missing its abdomen?

There is one specimen identified as quinquistrigella in the Barcode of Life Database, here. It looks just like albomarginata, except the scale bar indicates it is much smaller, with wings only 2 mm long. I am certain that scale bar is incorrect, and I’m not sure I trust any of those scale bars. That specimen was collected in Texas in 1939, and although the label data on the BOLD website don’t say as much, I think it must be the 1939 specimen that Don said had been reared from Sphaeralcea. Troublingly, it is clearly also the same specimen that Don told me was the type. This, I suppose, explains why it is in such good condition; I have seen a lot of Chambers’ type specimens at Harvard’s Museum of Comparative Zoology, and they tend to be in pretty sorry shape. Here, for instance, is the type of Phyllocnistis populiella, the species that makes those beautiful serpentine squiggles on poplar leaves:

One way to move forward would be to compare genitalia and/or DNA from specimens reared from Fabaceae (Centrosema), Euphorbiaceae (Tragia), and Malvaceae (Sida, Sphaeralcea) and see how many species are involved. It would be very unusual for a single gracillariid species to have such disparate host plants. At this point, genitalia-wise, all I have available for comparison is the photo of the (male) type specimen of albomarginatum, which was not reared. I haven’t yet checked what sex my specimens are, but I have the one from Sphaeralcea (Texas) and four from Tragia—two from Mike Palmer in Oklahoma, and two from Chet Burrier in Texas. If there turn out to be multiple species in Texas that look like this, there may be no way to determine which one is quinquistrigella, although getting a look at the actual type specimen would be a good start.

That one alleged quinquistrigella specimen has not been assigned a BIN (Barcode Identification Number), but it does have a partial sequence, so we can visually check to see how well it matches the Oklahoma albomarginatum specimens. Here’s the “quinquistrigella” (the Ns are the missing bits):

AACACTTTATTTTATATTTGGCATTTGATCAGGAATAGTAGGAACATCCTTAAGTTTATT
AATTCGAGCTGAATTAGGGAATCCAGGATCCTTAATTGGAGATGATCAAATTTATAACAC
TATTGTAACTGCTCACGCTTTTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCCTTCCCTCG
TCTAAATAATATAAGATTTTGATTACTTCCACCCTCCCTAATCTTACTAATTTCAAGGAG
TATTGTTGAAAACGGAGCTGGAACTGGTTGAACTGTCTACCCACCTTTATCATCTAATAT
TGCCCATGGAGGAAGATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATCTC
TTCTATTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTCTTTTACTTCT
ATTATCATTACCTGTACTAGCCGGAGCAATTACAATACTATTAACAGACCGTAATTTAAA
TACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATCTTATACCAACATTTATTT

and one of the albomarginatum specimens:

AACACTTTATTTTATATTTGGCATTTGATCAGGAATAGTAGGAACATCCTTAAGTTTATT
AATTCGAGCTGAATTAGGGAATCCAGGATCCTTAATTGGAGATGATCAAATTTATAACAC
TATTGTAACTGCTCACGCTTTTATTATAATTTTTTTTATAGTGATACCAATTATAATTGG
TGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCCTTCCCTCG
TCTAAATAATATAAGATTTTGATTACTTCCACCCTCCCTAATCTTACTAATTTCAAGGAG
TATTGTTGAAAACGGAGCTGGAACTGGTTGAACTGTCTACCCACCTTTATCATCTAATAT
TGCCCATGGAGGAAGATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATCTC
TTCTATTTTAGGAGCTATCAATTTTATTACTACAATTATCAACATACGACCAAATGGAAT
AACATTTGATAATATACCACTATTTGCTTGAGCAGTTGGTATTACCGCTCTTTTACTTCT
ATTATCATTACCTGTACTAGCCGGAGCAATTACAATACTATTAACAGACCGTAATTTAAA
TACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATCTTATATCAACATTTATTT

I copied and pasted these into a Word document just now, colored the “quinquistrigella” in red, and shuffled the two together so we can compare them line by line. Ignoring the “N”s, they appear to be identical except for one T-C substitution, which I’ve highlighted in yellow below (and I’ve put this in boldface in the two sequences above, but it’s a little subtle):

Not a big enough difference to say these are two different species, for sure. If both August Busck and Don Davis made their identifications of albomarginatum based on comparison of the genitalia with the type specimen of that species (and this may be possible to determine, eventually*), then this suggests that the mallow feeder could in fact be the same as the legume feeder. (There is some precedent for this; the leaf-mining fly Calycomyza malvae feeds on both mallows and legumes.) It doesn’t tell us anything about the true identity of quinquistrigella, but it’s a start. If the Tragia feeder turns out to be the same as the mallow feeder, there will be a strong case for synonymizing albomarginatum with quinquistrigella.

So, to answer your question, Steve, I don’t know. I guess it’s fine for now, except I’ve moved albomarginatum to Ornixolinae on BugGuide, so that it’s grouped with quinquistrigella under “genus undetermined.”

* Added the next morning: As I was closing the numerous tabs I had opened on my browser while writing this post, I noticed that this specimen shown on BOLD (from which no DNA sequence was obtained) has the following note: “E.E.A. de Cuba No. 9679|Pupated: Dec.21.1931|Genitalia on slide AB Mar/6/1937; leaf miner on Bradburya plumieri.” So August Busck did dissect at least one of those reared specimens from Cuba, and the genitalia slide is at the Smithsonian, so surely Don would have seen it (although this one is a female). It’s still a mystery why Don was identifying some specimens as albomarginatum and others as quinquistrigella, and whether the alleged quinquistrigella female he illustrated showed any differences with albomarginatum.

Another thing I thought to check just now is that the Barcode Identification Number for albomarginatum (BOLD:ABX0021) has its nearest neighbor at a distance of 10%, and that is the South American species Acrocercops serrigera, which feeds on mallows**. That BIN, in turn, has its nearest neighbor at a distance of 8%—an undetermined gracillariid that has been collected in Florida, Mexico, and Costa Rica. Both of these moths look very much like albomarginatum and quinquistrigella, except they appear to lack the dark speckles in the white dorsal margin.

…And another update! (February 16, 2025): This morning I started organizing my copies of Don Davis’s genitalia drawings in a way that will make things easier to find, and I discovered that I do in fact have his drawings of male and female albomarginatum genitalia. In the male drawing, there are a number of differences with the type specimen that seem rather significant to me. Unfortunately his drawings don’t generally indicate what specimens they are based on, but there are some drawings that are annotated with “holotype” or “paratype,” and this isn’t one of them. It therefore seems likely that these are based on the specimens from Oklahoma (or Arkansas, if such specimens exist). I suppose they could also be based on Busck’s slides, but in any case they represent Don’s concept of albomarginatum. Pending further investigation, I am inclined to think the North American record of albomarginatum is based on a misidentification. Supporting evidence includes the facts that BIN BOLD:ABX0021 only has specimens from Oklahoma and Texas (none from the Caribbean), and that no one has yet found mines on Centrosema in North America that could have been made by anything related to these moths (but this is only relevant if Busck’s identification of the reared Cuban specimens was correct).

Once I’ve got my slide-mounting issues worked out, I can dissect my specimens from Sphaeralcea and Tragia and see how they compare with one another, and with Don’s drawings, and with the type of albomarginatum. And hopefully I can get DNA barcodes from them at some point. Then there’s the matter of comparing these moths against the 28 described genera of Ornixolinae to see if any of them fit, before contemplating describing a new one.

** Bernard Landry’s 2006 paper describing the subspecies Acrocercops serrigera galapagosensis states that the larvae feed on flower buds of Waltheria ovata, rather than being leafminers. The genitalia in his figure are more similar to the type of albomarginatum than is what Don Davis illustrated for albomarginatum. The next species described in Landry’s paper, incidentally, is Caloptilia dondavisi.