TULIP currently consists of two Perl scripts, tulipseed.perl and tulipbulb.perl. These are very much intended as prototypes, and additional components and/or implementations are likely to follow.
Tulipseed takes as input alignments files of long reads to sparse short seeds, and outputs a graph and scaffold structures.
Tulipbulb adds long read sequencing data to these.
- Input data
eel_seeds_285.fasta:
These are pre-selected seed sequenced, with selection criteria 'not too repetitive'. Seeds containing repetitive sequences should be fine, but it will then take much longer to untangle the graph, and to optimize seed numbers. Strict requirements are that seed sequence identifiers are unique numbers (excluding 0), and that all seeds are of exactly the same length.
Example file:
>53
TCTGTATAATTTTTTTTTTTTCAAAAAGAAATGTCACAATTATTCACACCCCAGTTTTCAGCACCCTCTCTTAACAAGGACATTCTTCTGTAATATTTTATGAGATAGATGGACACATCCTTGTCCATTCTTGCATACACCATCTTTCTAAATTTTCTACTGAAAATGTCCTCCTCAGTTCAAACCAGAAAATTTGGTTACATTCTGGAAACTTGAATATTGATCCAGAGACAAAAACAGCAAAACAGTAATTTTGTGGTAAATTAATCATTTATTGGTTGAGTT
>118
GTTGCAAGCATATTTTAGCATTCCTTTAGCTCAAAAGTTTCTCATTTTTTTCTTGCCCATTATCAACAGTGACAAATTCTTCTGATATACATCTTTCTGATGTTTGTGGTTCCACATTGGCCTTCTCCTGCATTGTGGTATTTCTACTTTGTTTAGTTAATCAGCTGTTGAAATTAGCCTTTAGTCCCACAGGGAATTACAGGAATTGTGGTATACACTGTTATAAGCAATATACATTTTATTTTATGATACCTGCTAAAGAAGGTAATATGTCAGATGTTATAG
>154
TTCTGAATTCCTTTAAGACTTCAAGGTGAATGGTGAATTAAAGTGCTGCCATCATATAGGCTGTTTAAAGGCAGTTTTAAATGATTTTATATATATTTTATATGATTACAGACAATGTGATTCATGAAGAAAATGTGGGCAGTCCTTTTCCCTGTAGCAAGGTCAGTAAAATAATAGTGACAGAATAATGTGCTTGACGTCTCTAATTTTACAATCTCATATACCACTGTATGCCTATGTGAGTCAAATATGATATAAAATTGAACATTATTATGTTTGTAATGG
long_reads.fasta:
Long reads on one line and in FASTA format. The read identifiers should be unique in each file, so be careful if you concatenate data!
- Alignments
We used BWA MEM to align reads to seeds, but other aligners should work. Currently, TULIP accepts SAM format (support for other formats, e.g. DALIGNER output, was present in an earlier versions and might reappear). Only the first 6 fields of the SAM alignment information is used (up to and including the CIGAR string), so you might want to clip off the rest.
Command lines:
bwa index -p 285_seeds eel_seeds_285.fasta
bwa mem -t 4 -k 14 -W 45 -r 10 -A 1 -B 1 -O 1 -E 1 -L 0 285_seeds R7.3.fasta | cut -f 1,2,3,4,5,6 > R73_vs_285.shortsam
bwa mem -t 4 -k 16 -W 50 -r 10 -A 1 -B 1 -O 1 -E 1 -L 0 285_seeds R9_pass_1d.fasta | cut -f 1,2,3,4,5,6 > R91D_vs_285.shortsam
bwa mem -t 4 -k 19 -W 60 -r 10 -A 1 -B 1 -O 1 -E 1 -L 0 285_seeds R9_pass_2d.fasta | cut -f 1,2,3,4,5,6 > R92D_vs_285.shortsam
bwa mem -t 4 -k 16 -W 60 -r 10 -A 1 -B 1 -O 1 -E 1 -L 0 285_seeds R9.4_pass_1d.fasta | cut -f 1,2,3,4,5,6 > R941D_vs_285.shortsam
- Configuration
When using multiple alignment files, you should specify their locations in a short configuration file, format type [tab] alignment [tab] original fasta:
sam R92D_vs_285.shortsam R9_pass_2d.fasta
sam R91D_vs_285.shortsam R9_pass_1d.fasta
sam R941D_vs_285.shortsam R9.4_pass_1d.fasta
sam R73_vs_285.shortsam R7.3.fasta
- TULIP seed layout
./tulipseed.perl --seedlength 285 --config alignments.txt --diploid --out tulip/eel
This will generate the following files:
tulip/eel.graph The seed graph, text format
tulip/eel.graph_tmp The seed graph, binary format
tulip/eel.scaffolds Ordered seed scaffolds, text format
tulip/eel.scaffolds_tmp Ordered seed scaffolds, binary format
tulip/eel.seeds_tmp Seed usage information
tulip/eel.layout_log A log file
tulip/eel.scaffolds_stats Length statistics per scaffold
The _.*tmp files will be used by tulipbulb.perl.
The .graph file simply lists which seeds are connected in the final simplified graph:
100002 ii 3501405 10 1 432 559.50 585 43.49 2284
100002 oo 5662469 12 1 -60 -56.92 -53 2.75 2284
1000042 ii 2229111 5 1 2120 2370.40 2587 190.04 1019
1000042 oi 6256249 4 1 3531 3656.50 3963 178.04 1019
1000048 io 5919951 6 1 1509 1540.33 1628 40.46 1598
1000048 oi 672698 7 1 1107 1149.57 1225 34.42 1598
1000049 ii 239093 3 1 629 646.33 668 16.21 1193
Columns indicate:
* Seed 1 Name of the first seed
* Orientation ii | io | oi | oo, how seeds are connected (in/out)
* Seed 2 Name of the second seed
* Evidence The number of long read alignments connecting these seeds
* Hypothetical 1 = actual link, 0 = inferred link
* Minimum Minimum gap between the seeds observed in the alignments
* Mean Mean gap between the seeds observed in the alignments
* Maximum Maximum gap between the seeds observed in the alignments
* StDev Standard deviation of the gap estimate
* Scaffold Final scaffold ID
- TULIP bundling
./tulipbulb --seeds eel_seeds_285.fasta --config alignments.txt --input tulip/eel --out bulb/eel
This will add sequence from the original seeds and reads to the graph output by tulipseed.perl.
Output files are:
bulb/eel_readbundle_999.fasta The reads used to construct scaffold 999
bulb/eel_scaffold_999.fasta The sequence for scaffolds 999
bulb/eel.bundle_log A log file
For each scaffold, two files are generated. The scaffold sequence shows sequence derived from seeds and long reads in upper and lower case, respectively.
The tulipbulb.perl script contains a bug which prevents it from adding sequence in rare cases (it will then add gaps, NNNs). We will fix this soon, and also add some additional output options.